MSP primer design

Methylation-specific PCR (MSP) is a particularly demanding application as, in order to provide reliable results, it requires high specificity to discriminate between cytosine and thymine bases derived from methylated and unmethylated cytosines following bisulfite conversion.

Primer design for methylation-specific PCR is often difficult due to the need to cover several CpG sites per primer. This does not allow the detection of a single CpG methylation in a CpG island.

Primers should contain at least one CpG site within their sequence, and ideally be located at the far 3'-end of their sequence in order to discriminate maximally methylated DNA against unmethylated DNA.

Primers should have an adequate number of non-CpG Cs in their sequence to amplify only the bisulfite-modified DNA. Primers with more non-CpG Cs are preferred.

Primers for methylated DNA (M pair) and for unmethylated DNA (U pair) should contain the same CpG sites within their sequence. For example, if a forward primer in the M pair has this sequence: ATTAGTTTCGTTTAAGGTTCGA, the forward primer in the U pair must also contain the two CpG sites, e.g., ATTAGTTTTGTTTAAGGTTTGA; although they may differ in length and start position. The M pair and U pair should also ideally have a similar annealing temperature.