What information is provided with FlexiPlate siRNAs?

With FlexiPlate siRNA, you receive a CD with an Excel file that contains the following information (example):

• Plate ID: 1
• Row: A
• Column: 2
• Entrez Gene ID: 9210
• NCBI Gene Symbol: BMP15
• Gene description: bone morphogenetic protein 15
• siRNA target sequence (for HP GenomeWide siRNAs): TCGGAGTATAAGTATGAATTCCAA
• RefSeq ID (mRNA accession): NM_00222
• mRNA location: 756
• mRNA region: CDS
• Catalog number SIxxxxxx